Iright
BRAND / VENDOR: Proteintech

Proteintech, G30000-0-5C, MultiPro® 5CFLX Rabbit IgG Isotype Control (Polyclonal)

CATALOG NUMBER: G30000-0-5C
Regular price$0.99
/
Shipping calculated at checkout.
  • In stock, ready to ship

  • Backordered, shipping soon

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description
Size: 10ug The Rabbit IgG control (G30000-0-5C) by Proteintech is a Polyclonal antibody targeting Rabbit IgG control in Single Cell (Intra) applications with reactivity to NA samples G30000-0-5C targets Rabbit IgG control in Single Cell (Intra) applications and shows reactivity with NA samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test Background Information This product is Normal rabbit IgG (without immunized) which purified with Protein A. Normal Rabbit IgG is an isotype control antibody, which is used to estimate the non-specific binding of target primary antibodies due to Fc receptor binding or other protein-protein interactions. An isotype control antibody should have the same immunoglobulin type and be used at the same concentration as the test antibody. Specification Tested Reactivity: NA Host / Isotype: Rabbit / IgG Class: Oligo Conjugate Type: Polyclonal Immunogen: N/A Predict reactive species Full Name: MultiPro® 5CFLX Rabbit IgG Isotype Control (Polyclonal) RRID: AB_3673897 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGTCCATACGGCCGCACCCCATATAAGAAA Barcode Sequence: TCCATACGGCCGCAC Form: Liquid Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.

Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924