Proteintech, G60315-1-5C, MultiPro® 5CFLX Anti-Human c-SRC (5E10C4)

Size: 10ug The c-SRC (G60315-1-5C) by Proteintech is a Monoclonal antibody targeting c-SRC in Single Cell (Intra) applications with reactivity to Human samples G60315-1-5C targets c-SRC in Single Cell (Intra) applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test Background Information SRC, also named as SRC1 and p60-Src, belongs to the protein kinase superfamily, Tyr protein kinase family and SRC subfamily. It is a non-receptor protein tyrosine kinase that plays pivotal roles in numerous cellular processes such as proliferation, migration, and transformation. In concert with PTK2B, SRC plays an important role in osteoclastic bone resorption. It promotes energy production in osteoclasts by activating mitochondrial cytochrome C oxidase. Specification Tested Reactivity: Human Host / Isotype: Mouse / IgG2b Class: Oligo Conjugate Type: Monoclonal Immunogen: CatNo: Ag22306 Product name: Recombinant human c-SRC protein Source: e coli. -derived, PET30a Tag: 6*His Domain: 1-536 aa of BC011566 Sequence: MGSNKSKPKDASQRRRSLEPAENVHGAGGGAFPASQTPSKPASADGHRGPSAAFAPAAAEPKLFGGFNSSDTVTSPQRAGPLAGGVTTFVALYDYESRTETDLSFKKGERLQIVNNTEGDWWLAHSLSTGQTGYIPSNYVAPSDSIQAEEWYFGKITRRESERLLLNAENPRGTFLVRESETTKGAYCLSVSDFDNAKGLNVKHYKIRKLDSGGFYITSRTQFNSLQQLVAYYSKHADGLCHRLTTVCPTSKPQTQGLAKDAWEIPRESLRLEVKLGQGCFGEVWMGTWNGTTRVAIKTLKPGTMSPEAFLQEAQVMKKLRHEKLVQLYAVVSEEPIYIVTEYMSKGSLLDFLKGETGKYLRLPQLVDMAAQIASGMAYVERMNYVHRDLRAANILVGENLVCKVADFGLARLIEDNEYTARQGAKFPIKWTAPEAALYGRFTIKSDVWSFGILLTELTTKGRVPYPGMVNREVLDQVERGYRMPCPPECPESLHDLMCQCWRKEPEERPTFEYLQAFLEDYFTSTEPQYQPGENL Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human c-SRC (5E10C4) Calculated Molecular Weight: 60 kDa GenBank Accession Number: BC011566 Gene Symbol: SRC Gene ID (NCBI): 6714 ENSEMBL Gene ID: ENSG00000197122 RRID: AB_3673902 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGGGTACAAGGCTCATCCCCATATAAGAAA Barcode Sequence: GGTACAAGGCTCATC Form: Liquid UNIPROT ID: P12931 Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.