Proteintech, G65056-1-5C, MultiPro® 5CFLX Anti-Human CD14 (UCHM-1)

Size: 10ug The CD14 (G65056-1-5C) by Proteintech is a Monoclonal antibody targeting CD14 in Single Cell applications with reactivity to Human samples G65056-1-5C targets CD14 in Single Cell applications and shows reactivity with Human samples. Tested Applications Positive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL: <0.5ug/test Background Information CD14 is a 50-55 kDa glycosylphosphatidylinositol-anchored glycoprotein preferentially expressed on monocytes and macrophages, and at lower levels on granulocytes (PMID: 3385210; 2462937; 7685797). CD14 can also exist as a soluble protein. CD14 acts as a co-receptor for bacterial liposaccharides (LPS) (PMID: 1698311). It plays a major role in the inflammatory response of monocytes to LPS. Specification Tested Reactivity: Human Host / Isotype: Mouse / IgG2a Class: Oligo Conjugate Type: Monoclonal Immunogen: Thymocytes and peripheral blood lymphocytes from a remission AML patient Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human CD14 (UCHM-1) Calculated Molecular Weight: 375 aa, 40 kDa GenBank Accession Number: BC010507 Gene Symbol: CD14 Gene ID (NCBI): 929 ENSEMBL Gene ID: ENSG00000170458 RRID: AB_3673906 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGCTTGCGTCTACCGCCCCCATATAAGAAA Barcode Sequence: CTTGCGTCTACCGCC Form: Liquid UNIPROT ID: P08571 Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.