Proteintech, G65063-1-5C, MultiPro® 5CFLX Anti-Human CD44 (F10-44-2)

Size: 10ug The CD44 (G65063-1-5C) by Proteintech is a Monoclonal antibody targeting CD44 in Single Cell (Intra), Single Cell applications with reactivity to Human samples G65063-1-5C targets CD44 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Positive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test SINGLE CELL: <0.5ug/test Background Information CD44 is a type I transmembrane glycoprotein expressed on embryonic stem cells and in various levels on other cell types including connective tissues and bone marrow. CD44 expression is also upregulated in subpopulations of cancer cells and is recognized as a molecular marker for cancer stem cells (PMID: 29747682). It is a cell-surface receptor that mediates cell-cell and cell-matrix interactions through its affinity for hyaluronic acid (HA) and possibly also through its affinity for other ligands (PMID: 10694938). Adhesion with HA plays an important role in cell migration, tumor growth and progression. CD44 is also involved in lymphocyte activation, recirculation and homing, and in hematopoiesis. Specification Tested Reactivity: Human Host / Isotype: Mouse / IgG2a, kappa Class: Oligo Conjugate Type: Monoclonal Immunogen: Purified T cells from human lymph nodes Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human CD44 (F10-44-2) Calculated Molecular Weight: 742 aa, 82 kDa GenBank Accession Number: BC004372 Gene Symbol: CD44 Gene ID (NCBI): 960 ENSEMBL Gene ID: ENSG00000026508 RRID: AB_3673907 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGAACAGCGTGCCGATTCCCATATAAGAAA Barcode Sequence: AACAGCGTGCCGATT Form: Liquid UNIPROT ID: P16070 Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.