Proteintech, G65067-1-5C, MultiPro® 5CFLX Anti-Human CD56 (MEM-188)

Size: 10ug The CD56 (G65067-1-5C) by Proteintech is a Monoclonal antibody targeting CD56 in Single Cell (Intra) applications with reactivity to Human samples G65067-1-5C targets CD56 in Single Cell (Intra) applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test Background Information Neural cell adhesion molecule 1 (NCAM1, also known as CD56) is a cell adhesion glycoprotein of the immunoglobulin (Ig) superfamily. It is a multifunction protein involved in synaptic plasticity, neurodevelopment, and neurogenesis. NCAM1 is expressed on human neurons, glial cells, skeletal muscle cells, NK cells and a subset of T cells, and the expression is observed in a wide variety of human tumors, including myeloma, myeloid leukemia, neuroendocrine tumors, Wilms' tumor, neuroblastoma, and NK/T cell lymphomas. Specification Tested Reactivity: Human Host / Isotype: Mouse / IgG2a Class: Oligo Conjugate Type: Monoclonal Immunogen: Acute myelogenous leukemia cell line KG-1 Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human CD56 (MEM-188) GenBank Accession Number: BC014205 Gene Symbol: NCAM1 Gene ID (NCBI): 4684 ENSEMBL Gene ID: ENSG00000149294 RRID: AB_3673908 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGCTATCACTTGTCGTGCCCATATAAGAAA Barcode Sequence: CTATCACTTGTCGTG Form: Liquid UNIPROT ID: P13591 Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.