Proteintech, G65111-1-5C, MultiPro® 5CFLX Anti-Human CD38 (HIT2)

Size: 10ug The CD38 (G65111-1-5C) by Proteintech is a Monoclonal antibody targeting CD38 in Single Cell (Intra) applications with reactivity to Human samples G65111-1-5C targets CD38 in Single Cell (Intra) applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test Background Information CD38, also known as ADP-ribosyl cyclase 1, is a type II transmembrane glycoprotein with a short N-terminal cytoplasmic tail, a single membrane-spanning domain, and a C-terminal extracellular region with four N-glycosylation sites (PMID: 2319135). The extracellular domain of CD38 has bifunctional enzyme activities that catalyze synthesis of cyclic ADP ribose from nicotinamide adenine dinucleotide (NAD) and hydrolysis of cyclic ADP ribose to adenosine diphosphoribose (PMID: 10636863). CD38 is expressed on a variety of hematopoietic and non-hematopoietic cells and is involved in diverse processes such as generation of calcium-mobilizing metabolites, cell activation, and chemotaxis (PMID: 25938500). Specification Tested Reactivity: Human Host / Isotype: Mouse / IgG1, kappa Class: Oligo Conjugate Type: Monoclonal Immunogen: N/A Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human CD38 (HIT2) Calculated Molecular Weight: 300 aa, 34 kDa GenBank Accession Number: BC007964 Gene Symbol: CD38 Gene ID (NCBI): 952 ENSEMBL Gene ID: ENSG00000004468 RRID: AB_3673916 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGTTCGATGGTGATCGACCCATATAAGAAA Barcode Sequence: TTCGATGGTGATCGA Form: Liquid Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.