Proteintech, G65133-1-5C, MultiPro® 5CFLX Anti-Human CD3 (OKT3)

Size: 10ug The CD3 (G65133-1-5C) by Proteintech is a Monoclonal antibody targeting CD3 in Single Cell (Intra) applications with reactivity to Human samples G65133-1-5C targets CD3 in Single Cell (Intra) applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test Background Information CD3 is a multimeric protein associated with the T-cell receptor (TCR) to form a complex involved in antigen recognition and signal transduction (PMID: 15885124). CD3 is composed of CD3γ, δ, ε, and ζ chains (PMID: 1826255). It is expressed by thymocytes in a developmentally regulated manner, T cells, and some NK cells (PMID: 3289580). The TCR recognizes antigens bound to major histocompatibility complex (MHC) molecules. TCR-mediated peptide-MHC recognition is transmitted to the CD3 complex, leading to the intracellular signal transduction (PMID: 11985657). Specification Tested Reactivity: Human Host / Isotype: Mouse / IgG2a, kappa Class: Oligo Conjugate Type: Monoclonal Immunogen: Human T cells Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human CD3 (OKT3) Calculated Molecular Weight: 207 aa, 23 kDa GenBank Accession Number: BC049847 Gene Symbol: CD3 Gene ID (NCBI): 916 ENSEMBL Gene ID: ENSG00000198851 RRID: AB_3673918 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGTCGGATAAGACCTTCCCCATATAAGAAA Barcode Sequence: TCGGATAAGACCTTC Form: Liquid UNIPROT ID: P07766 Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.