Iright
BRAND / VENDOR: Proteintech

Proteintech, G65152-1-5C, MultiPro® 5CFLX Anti-Human CD5 (UCHT2)

CATALOG NUMBER: G65152-1-5C
Regular price$0.99
/
Shipping calculated at checkout.
  • In stock, ready to ship

  • Backordered, shipping soon

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description
Size: 10ug The CD5 (G65152-1-5C) by Proteintech is a Monoclonal antibody targeting CD5 in Single Cell (Intra), Single Cell applications with reactivity to Human samples G65152-1-5C targets CD5 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Positive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test SINGLE CELL: <0.5ug/test Background Information CD5 is a type I transmembrane glycoprotein of the scavenger receptor cysteine-rich family (PMID: 12403363). CD5 is expressed on a majority of thymocytes, mature T cells, B cell subsets, and peripheral blood dendritic cells (PMID: 9858516; 6156984; 10379049; 1384337). CD5 may act as a receptor in regulating T-cell proliferation. It functions as a negative regulator of TCR signaling during thymocyte development (PMID: 7542801). Specification Tested Reactivity: Human Host / Isotype: Mouse / IgG1, kappa Class: Oligo Conjugate Type: Monoclonal Immunogen: N/A Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human CD5 (UCHT2) Calculated Molecular Weight: 495 aa, 55 kDa GenBank Accession Number: BC027901 Gene Symbol: CD5 Gene ID (NCBI): 921 ENSEMBL Gene ID: ENSG00000110448 RRID: AB_3673921 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGGTGCCTCGCATTGCACCCATATAAGAAA Barcode Sequence: GTGCCTCGCATTGCA Form: Liquid Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.

Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924