Iright
BRAND / VENDOR: Proteintech

Proteintech, G65169-1-5C, MultiPro® 5CFLX Anti-Human CD163 (GHI/61)

CATALOG NUMBER: G65169-1-5C
Regular price$0.99
/
Shipping calculated at checkout.
  • In stock, ready to ship

  • Backordered, shipping soon

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description
Size: 10ug The CD163 (G65169-1-5C) by Proteintech is a Monoclonal antibody targeting CD163 in Single Cell (Intra) applications with reactivity to Human samples G65169-1-5C targets CD163 in Single Cell (Intra) applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test Background Information CD163, also known as M130, is a membrane glycoprotein which belongs to the scavenger receptor superfamily (PMID: 8370408). It is an acute phase-regulated and signal-inducing macrophage protein expressed exclusively in monocytes and tissue macrophages (PMID: 11196644). CD163 mediates endocytosis of haptoglobin-haemoglobin complexes (PMID: 11196644). The uptake of haptoglobin by macrophages contributes to the recycling of iron and also to the inflammatory response (PMID: 22900885). Soluble CD163 (sCD163), as a result of ectodomain shedding during inflammatory activation of macrophages, circulates in blood and has been suggested as a plasma/serum marker for macrophage activity (PMID: 12570164). Specification Tested Reactivity: Human Host / Isotype: Mouse / IgG1, kappa Class: Oligo Conjugate Type: Monoclonal Immunogen: Glycoprotein preparation from hairy cell leukemia spleen Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human CD163 (GHI/61) Calculated Molecular Weight: 1156 aa, 125 kDa GenBank Accession Number: BC051281 Gene Symbol: CD163 Gene ID (NCBI): 9332 ENSEMBL Gene ID: ENSG00000177575 RRID: AB_3673925 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGACCGCGACCTGATAACCCATATAAGAAA Barcode Sequence: ACCGCGACCTGATAA Form: Liquid UNIPROT ID: Q86VB7 Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.

Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924