Proteintech, G65186-1-5C, MultiPro® 5CFLX Anti-Human CD13 (WM15)

Size: 10ug The CD13 (G65186-1-5C) by Proteintech is a Monoclonal antibody targeting CD13 in Single Cell (Intra), Single Cell applications with reactivity to Human samples G65186-1-5C targets CD13 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Positive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test SINGLE CELL: <0.5ug/test Background Information CD13, also named as APN, ANPEP (aminopeptidase N) or PEPN, is belongs to the peptidase M1 family. CD13 is a heavily glycosylated, ~150-240 kDa, type-II membrane, expressed by most cells of myeloid origin including monocytes, macrophages, granulocytes, and their hematopoietic precursors. It is also abundantly expressed in the brush border of epithelial cells from renal proximal tubules and small intestine, in prostatic epithelial cells, in bile duct canaliculi, in mast cells, and, in some cases, in fibroblasts and smooth muscle cells. CD13 is a multifunctional protein and plays varying roles in cell migration, cell proliferation, cell differentiation and so on. CD13 participates in angiogenesis generating and modulating angiogenic signals, and can be a marker of angiogenic vessels. CD13 is also a pan-myeloid marker, present on mature granulocytes and monocytes. (PMID: 8805662, 10098327, 18603472, 18097955, 17897790, 17888402, 21339174) Specification Tested Reactivity: Human Host / Isotype: Mouse / IgG1, kappa Class: Oligo Conjugate Type: Monoclonal Immunogen: Human AML cells Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human CD13 (WM15) Calculated Molecular Weight: 110 kDa GenBank Accession Number: BC058928 Gene Symbol: CD13 Gene ID (NCBI): 290 ENSEMBL Gene ID: ENSG00000166825 RRID: AB_3673927 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGTTAATGAGTAGAGCGCCCATATAAGAAA Barcode Sequence: TTAATGAGTAGAGCG Form: Liquid UNIPROT ID: P15144 Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.