Proteintech, G65195-1-5C, MultiPro® 5CFLX Anti-Human CD81 (5A6)

Size: 10ug The CD81 (G65195-1-5C) by Proteintech is a Monoclonal antibody targeting CD81 in Single Cell (Intra) applications with reactivity to Human samples G65195-1-5C targets CD81 in Single Cell (Intra) applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test Background Information CD81 (also known as TAPA1or TSPAN28) is a membrane protein of the tetraspanin superfamily, which are characterized by the presence of four conserved transmembrane regions. Many of these members are expressed on leukocytes and have been implicated in signal transduction, cell-cell interactions, and cellular activation and development. CD81 is involved in signal transduction and cell adhesion in the immune system (PMID: 9597125). CD81 has also been identified as en essential receptor for HCV (hepatitis C virus) (PMID: 21428934). Specification Tested Reactivity: Human Host / Isotype: Mouse / IgG1, kappa Class: Oligo Conjugate Type: Monoclonal Immunogen: Human OCI-LY8 cell line Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human CD81 (5A6) Calculated Molecular Weight: 26 kDa GenBank Accession Number: BC002978 Gene Symbol: CD81 Gene ID (NCBI): 975 ENSEMBL Gene ID: ENSG00000110651 RRID: AB_3673932 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGGTCAATAGTTGGCTACCCATATAAGAAA Barcode Sequence: GTCAATAGTTGGCTA Form: Liquid UNIPROT ID: P60033 Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.