Proteintech, G65203-1-5C, MultiPro® 5CFLX Anti-Human CD7 (4H9)

Size: 10ug The CD7 (G65203-1-5C) by Proteintech is a Monoclonal antibody targeting CD7 in Single Cell (Intra) applications with reactivity to Human samples G65203-1-5C targets CD7 in Single Cell (Intra) applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test Specification Tested Reactivity: Human Host / Isotype: Mouse / IgG2a, kappa Class: Oligo Conjugate Type: Monoclonal Immunogen: T-acute lymphoblastic leukemia cells Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human CD7 (4H9) Calculated Molecular Weight: 240 aa, 25 kDa GenBank Accession Number: BC009293 Gene Symbol: CD7 Gene ID (NCBI): 924 ENSEMBL Gene ID: ENSG00000173762 RRID: AB_3673934 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGGTGGATTGAGAGCCACCCATATAAGAAA Barcode Sequence: GTGGATTGAGAGCCA Form: Liquid UNIPROT ID: P09564 Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.