Iright
BRAND / VENDOR: Proteintech

Proteintech, G66618-2-5C, MultiPro® 5CFLX Anti-Human SPI1 (2H3D3)

CATALOG NUMBER: G66618-2-5C
Regular price$0.99
/
Shipping calculated at checkout.
  • In stock, ready to ship

  • Backordered, shipping soon

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description
Size: 10ug The SPI1 (G66618-2-5C) by Proteintech is a Monoclonal antibody targeting SPI1 in Single Cell (Intra) applications with reactivity to Human samples G66618-2-5C targets SPI1 in Single Cell (Intra) applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test Background Information SPI1, also named as 31 kDa-transforming protein, is a 270 amino acid protein, which belongs to the ETS family. SPI1 is highly expressed in both FV-P and FV-A-induced erythro-leukemia cell lines that have undergone rearrangements of the SPI1 gene due to the insertion of SFFV. Specification Tested Reactivity: Human Host / Isotype: Mouse / IgG1 Class: Oligo Conjugate Type: Monoclonal Immunogen: Peptide Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human SPI1 (2H3D3) Calculated Molecular Weight: 31 kDa GenBank Accession Number: NM_003120 Gene Symbol: SPI1 Gene ID (NCBI): 6688 ENSEMBL Gene ID: ENSG00000066336 RRID: AB_3673957 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGGCAATAACCTCCGCGCCCATATAAGAAA Barcode Sequence: GCAATAACCTCCGCG Form: Liquid UNIPROT ID: P17947 Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.

Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924