Proteintech, G67537-1-5C, MultiPro® 5CFLX Anti-Human KLRB1/CD161 (3D8F5)

Size: 10ug The KLRB1/CD161 (G67537-1-5C) by Proteintech is a Monoclonal antibody targeting KLRB1/CD161 in Single Cell (Intra), Single Cell applications with reactivity to Human samples G67537-1-5C targets KLRB1/CD161 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Positive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test SINGLE CELL: <0.5ug/test Specification Tested Reactivity: Human Host / Isotype: Mouse / IgG1 Class: Oligo Conjugate Type: Monoclonal Immunogen: CatNo: Ag27117 Product name: Recombinant human KLRB1,CD161 protein Source: e coli. -derived, PET28a Tag: 6*His Domain: 68-225 aa of BC114516 Sequence: KSSIEKCSVDIQQSRNKTTERPGLLNCPIYWQQLREKCLLFSHTVNPWNNSLADCSTKESSLLLIRDKDELIHTQNLIRDKAILFWIGLNFSLSEKNWKWINGSFLNSNDLEIRGDAKENSCISISQTSVYSEYCSTEIRWICQKELTPVRNKVYPDS Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human KLRB1/CD161 (3D8F5) Calculated Molecular Weight: 225 aa, 25 kDa GenBank Accession Number: BC114516 Gene Symbol: CD161 Gene ID (NCBI): 3820 ENSEMBL Gene ID: ENSG00000111796 RRID: AB_3673965 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGTACTTGACTGGTTGCCCCATATAAGAAA Barcode Sequence: TACTTGACTGGTTGC Form: Liquid UNIPROT ID: Q12918 Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.