Iright
BRAND / VENDOR: Proteintech

Proteintech, G68047-1-5C, MultiPro® 5CFLX Anti-Human Phospho-MEK1 (Ser298) (3F10G10)

CATALOG NUMBER: G68047-1-5C
Regular price$0.99
/
Shipping calculated at checkout.
  • In stock, ready to ship

  • Backordered, shipping soon

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description
Size: 10ug The Phospho-MEK1 (Ser298) (G68047-1-5C) by Proteintech is a Monoclonal antibody targeting Phospho-MEK1 (Ser298) in Single Cell (Intra) applications with reactivity to Human samples G68047-1-5C targets Phospho-MEK1 (Ser298) in Single Cell (Intra) applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test Background Information MAP2K1 encodes MAPK1, also known as MEK1. MEK1 variants can enhance MEK1 expression and ERK1 phosphorylation that together lead to continuous activation of MEK/ERK signaling pathway. MEK1 bind directly to ERK2 through a region in the N terminus of MEK. In addition, a proline-rich (PR) regulatory sequence in MEK is also involved in MEK-ERK association and signal propagation. The coupling between MEK1 and ERK2 is enhanced through phosphorylation on S298 in the MEK1 PR region, whereas phosphorylation on MEK1 T292 releases the complex. MEK1 T292 is a substrate of ERK2, but the site is also phosphorylated at a basal level when ERK2 is inhibited, suggesting several regulators of this site . Although the S298 site in MEK2 has been conserved, it lacks the T292 phosphorylation site, and it is not a substrate of PAK1. (PMID: 31972311, PMID: 17928366, PMID: 22177953) Specification Tested Reactivity: Human Host / Isotype: Mouse / IgG1 Class: Oligo Conjugate Type: Monoclonal Immunogen: Peptide Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human Phospho-MEK1 (Ser298) (3F10G10) Calculated Molecular Weight: 43 kDa GenBank Accession Number: BC139729 Gene Symbol: MEK1 Gene ID (NCBI): 5604 ENSEMBL Gene ID: ENSG00000169032 RRID: AB_3673970 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGTGCTCTAATAGTCGGCCCATATAAGAAA Barcode Sequence: TGCTCTAATAGTCGG Form: Liquid UNIPROT ID: Q02750 Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.

Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924