Proteintech, G69001-1-5C, MultiPro® 5CFLX Anti-Human IL-6 (4G3E6)

Size: 10ug The NeutraKine® IL-6 (G69001-1-5C) by Proteintech is a Monoclonal antibody targeting NeutraKine® IL-6 in Single Cell (Intra) applications with reactivity to Human samples G69001-1-5C targets NeutraKine® IL-6 in Single Cell (Intra) applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test Background Information Interleukin-6 (IL-6) is an interleukin that acts as both a pro-inflammatory and anti-inflammatory cytokine. IL-6 protein is secreted by a variety of cell types including T cells and macrophages as phosphorylated and variably glycosylated molecule. IL-6 plays an essential role in the final differentiation of B-cells into Ig-secreting cells involved in lymphocyte and monocyte differentiation. It induces myeloma and plasmacytoma growth and induces nerve cells differentiation Acts on B-cells, T-cells, hepatocytes, hematopoietic progenitor cells and cells of the CNS. IL-6 is also considered a myokine, a cytokine produced from muscle, and is elevated in response to muscle contraction. IL-6 has been shown to interact with interleukin-6 receptor and glycoprotein 130. Additionally, IL-6 is involved in hematopoiesis, bone metabolism, and cancer progression, and has been defined an essential role in directing transition from innate to acquired immunity.This antibody can be used to neutralize the bioactivity of IL-6. Specification Tested Reactivity: Human Host / Isotype: Mouse / IgG1 Class: Oligo Conjugate Type: Monoclonal Immunogen: RecombinantProtein Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human IL-6 (4G3E6) Gene Symbol: IL6 Gene ID (NCBI): 3569 ENSEMBL Gene ID: ENSG00000136244 RRID: AB_3673972 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGACCGCACAGCGAATTCCCATATAAGAAA Barcode Sequence: ACCGCACAGCGAATT Form: Liquid Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.