Proteintech, G69007-1-5C, MultiPro® 5CFLX Anti-Human IFN Gamma (1E10G7)

Size: 10ug The NeutraKine® IFN Gamma (G69007-1-5C) by Proteintech is a Monoclonal antibody targeting NeutraKine® IFN Gamma in Single Cell (Intra) applications with reactivity to Human samples G69007-1-5C targets NeutraKine® IFN Gamma in Single Cell (Intra) applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test Background Information Interferon gamma (IFNG) is a soluble cytokine that is the only member of the type II class of interferons. It is secreted by Th1 cells, cytotoxic T cells and NK cells. The cytokine is associated with antiviral, immunoregulatory and anti-tumor properties and is a potent activator of macrophages. It plays crucial roles in pathogen clearance. Aberrant IFNG expression is associated with a number of autoinflammatory and autoimmune diseases. It has been identified in many studies as a biomarker for pleural tuberculosis (TB). Mutations in this gene are associated with aplastic anemia.This antibody can be used to neutralize the bioactivity of Interferon gamma. Specification Tested Reactivity: Human Host / Isotype: Mouse / IgG1 Class: Oligo Conjugate Type: Monoclonal Immunogen: CatNo: Product name: HumanKine® recombinant human IFN gamma protein Source: -derived, Tag: Domain: of Sequence: Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human IFN Gamma (1E10G7) Gene Symbol: IFNG Gene ID (NCBI): 3458 ENSEMBL Gene ID: ENSG00000111537 RRID: AB_3673973 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGCGAGAGAATGACTGCCCCATATAAGAAA Barcode Sequence: CGAGAGAATGACTGC Form: Liquid Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.