Proteintech, G69021-1-5C, MultiPro® 5CFLX Anti-Human IL-17A (1F3E3)

Size: 10ug The NeutraKine® IL-17A (G69021-1-5C) by Proteintech is a Monoclonal antibody targeting NeutraKine® IL-17A in Single Cell (Intra) applications with reactivity to Human samples G69021-1-5C targets NeutraKine® IL-17A in Single Cell (Intra) applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test Background Information IL17A, also named as IL-17, is a proinflammatory cytokine. IL-17, synthesized only by memory T cells and natural killer cells, has pleiotropic effects, mainly in the recruitment and activation of neutrophils. This cytokine regulates the activities of NF-kappaB and mitogen-activated protein kinases. This cytokine can stimulate the expression of IL6 and cyclooxygenase-2 (PTGS2/COX-2), as well as enhance the production of nitric oxide (NO). High levels of this cytokine are associated with several chronic inflammatory diseases including rheumatoid arthritis, psoriasis and multiple sclerosis. The IL-17 receptor is a type I transmembrane protein, that is widely expressed on epithelial cells, fibroblasts, B and T cells, and monocytic cells. In psoriatic skin lesions, both Th17 cells and their downstream effector molecules, e.g. IL-17 and IL-22, are highly increased.This antibody can be used to neutralize the bioactivity of IL-17A. Specification Tested Reactivity: Human Host / Isotype: Mouse / IgG1 Class: Oligo Conjugate Type: Monoclonal Immunogen: RecombinantProtein Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human IL-17A (1F3E3) Gene Symbol: IL-17A Gene ID (NCBI): 3605 ENSEMBL Gene ID: ENSG00000112115 RRID: AB_3673974 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGCTAGCGCTACCTAACCCCATATAAGAAA Barcode Sequence: CTAGCGCTACCTAAC Form: Liquid Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.