Iright
BRAND / VENDOR: Proteintech

Proteintech, G81042-1-5C, MultiPro® 5CFLX Anti-Human Lamin A/C (5I16)

CATALOG NUMBER: G81042-1-5C
Regular price$0.99
/
Shipping calculated at checkout.
  • In stock, ready to ship

  • Backordered, shipping soon

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description
Size: 10ug The Lamin A/C (G81042-1-5C) by Proteintech is a Recombinant antibody targeting Lamin A/C in Single Cell (Intra) applications with reactivity to Human samples G81042-1-5C targets Lamin A/C in Single Cell (Intra) applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test Background Information Lamin A/C is also named as LMNA, or LMN1. The lamin family of proteins make up the matrix and are highly conserved in evolution. During mitosis, the lamina matrix is reversibly disassembled as the lamin proteins are phosphorylated. Lamin proteins are thought to be involved in nuclear stability, chromatin structure and gene expression. The lack of lamin A/C can be as a novel marker for undifferentiated embryonic stem cells and lamin A/C expression is as an early indicator of differentiation (PMID: 16179429). Mutations in this gene lead to several diseases: Emery-Dreifuss muscular dystrophy, familial partial lipodystrophy, limb girdle muscular dystrophy, dilated cardiomyopathy, Charcot-Marie-Tooth disease, and Hutchinson-Gilford progeria syndrome. This protein has 4 isoforms produced by alternative splicing with the molecular weight of 74 kDa, 65 kDa, 70 kDa and 64 kDa. This antibody can recognize 4 isoforms of Lamin A/C. Specification Tested Reactivity: Human Host / Isotype: Rabbit / IgG Class: Oligo Conjugate Type: Recombinant Immunogen: CatNo: Ag0408 Product name: Recombinant human Lamin A/C protein Source: e coli. -derived, PGEX-4T Tag: GST Domain: 26-198 aa of BC003162 Sequence: ITRLQEKEDLQELNDRLAVYIDRVRSLETENAGLRLRITESEEVVSREVSGIKAAYEAELGDARKTLDSVAKERARLQLELSKVREEFKELKARNTKKEGDLIAAQARLKDLEALLNSKEAALSTALSEKRTLEGELHDLRGQVAKLEAALGEAKKQLQDEMLRRVDAENRLQ Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human Lamin A/C (5I16) Calculated Molecular Weight: 65 kDa GenBank Accession Number: BC003162 Gene Symbol: Lamin A/C Gene ID (NCBI): 4000 ENSEMBL Gene ID: ENSG00000160789 RRID: AB_3673977 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGAAGTGGAGTGTGTCTCCCATATAAGAAA Barcode Sequence: AAGTGGAGTGTGTCT Form: Liquid UNIPROT ID: P02545 Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.

Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924