BRAND / VENDOR: Thermo Fisher

Thermo Fisher, EP0111, T7 RNA Polymerase (20 U/μL)

CATALOG NUMBER: EP0111

Regular price$0.99
/
Shipping calculated at checkout.
  • 99 items in stock
  • Backordered, shipping soon

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description

20U/µL, 5000 U Thermo Scientific Bacteriophage T7 RNA polymerase is a DNA-dependent RNA polymerase with strict specificity for its respective double-stranded promoters. It catalyzes the 5'→3' synthesis of RNA on either single-stranded DNA or double-stranded DNA downstream from it promoter.
Highlights
• Incorporates modified nucleotides (e.
g., aminoallyl-, biotin-, fluorescein-, digoxigenin-labeled nucleotides)ApplicationsSynthesis of unlabeled and labeled RNA that can be used:
• For hybridization,in vitroRNA translation
• As aRNA, siRNA, substrate in RNase protection assays, template for genomic DNA sequencing
• In studies of RNA secondary structure and RNA-protein interactions, RNA splicingConsensus promoter sequence:T7: TAATACGACTCACTATAGGGAGAConcentration: 20U/µL
Quantity: 5,000 units
Polymerase: T7 RNA Polymerase
Unit Size: Each

Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924