Product Description
20U/µL, 5 x 5000 U Thermo Scientific Bacteriophage T7 RNA polymerase is a DNA-dependent RNA polymerase with strict specificity for its respective double-stranded promoters. It catalyzes the 5'→3' synthesis of RNA on either single-stranded DNA or double-stranded DNA downstream from it promoter.
Highlights
• Incorporates modified nucleotides (e.
g., aminoallyl-, biotin-, fluorescein-, digoxigenin-labeled nucleotides)ApplicationsSynthesis of unlabeled and labeled RNA that can be used:
• For hybridization,in vitroRNA translation
• As aRNA, siRNA, substrate in RNase protection assays, template for genomic DNA sequencing
• In studies of RNA secondary structure and RNA-protein interactions, RNA splicingConsensus promoter sequence:T7: TAATACGACTCACTATAGGGAGAConcentration: 20U/µL
Quantity: 5 x 5,000 units
Polymerase: T7 RNA Polymerase
Unit Size: Each
Order Guidelines
1. Price & Stock Available on Request. Click to send email to: service@iright.com
2. Please DO NOT make payment before confirmtaion.
3. Minimum order value of $1,000 USD required.
4. 100% prepayment required.
Collaboration
Tony Tang
Email: Tony.Tang@iright.com
Mobile/WhatsApp/Wechat: +86-17717886924