Iright
BRAND / VENDOR: Thermo Fisher

Thermo Fisher, SO114, M13/pUC Sequencing Primer (-46), 22-mer

CATALOG NUMBER: SO114
Regular price$0.99
/
Shipping calculated at checkout.
  • In stock, ready to ship

  • Backordered, shipping soon

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description

Thermo Fisher, SO114, M13/pUC Sequencing Primer (-46), 22-mer Thermo Scientific M13/pUC Sequencing Primer (-46), 22-mer is a synthetic single-stranded 22-mer oligonucleotide with free 5'- and 3'-hydroxyl ends. This M13/pUC primer anneals to the region in the 5'-terminus of the lacZ gene. All primers are supplied as 10 μM aqueous solutions.
Applications
• Sequencing of DNA fragments inserted into the MCS within the lacZ gene of various cloning vectors, such aspUC19, pTZ19R, pTZ57R, M13mp18, and pBluescript II
• Colony screening by PCRPrimer Sequence:5'-d(GCCAGGGTTTTCCCAGTCACGA)-3'For Use With (Application): Sequencing
Form: Liquid
Product Type: Sequencing Primer
Quantity: 10 μM, 45 μL
Shipping Condition: Dry Ice
Vector: pUC19, pTZ19R, pTZ57R, M13mp18, pBluescript II
Concentration: 10 μM
Primer: M13
Unit Size: 10 µM


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924